Chinese Medical Journal
Volume 132 · Issue 23 · 2019
Chinese Medical Journal
No DataDespite a growing population of patients starting hemodialysis in China, little is known about markers of mineral bone disease (MBD) and their management. We present data on prevalence and correlates of hypocalcemia, hyperphosphatemia, and secondary hyperparathyroidism from the China Dialysis Outcomes and Practice Patterns Study (DOPPS), with evaluation of whether these laboratory markers triggered changes in management.
We compared the frequency of measurement and prevalence of poor control of MBD markers in China DOPPS with other DOPPS regions. We also used generalized estimating equations to assess correlates of MBD markers, and separate models to assess predictors of vitamin D and phosphate binder prescriptions in the China DOPPS.
Severe hyperphosphatemia (>7 mg/dL) and secondary hyperparathyroidism (>600 pg/mL) were common (27% and 21% prevalence, respectively); both were measured infrequently (14.9% and 3.2% of patients received monthly measurements in China). Frequency of dialysis sessions was positively associated with hyperphosphatemia; presence of residual kidney function was negatively associated with both hyperphosphatemia and secondary hyperparathyroidism. Laboratory measures indicating poor control of MBD were not associated with subsequent prescription of active vitamin D or phosphate binder.
There are substantial opportunities for improvement and standardization of MBD management in China. Development of country-specific guidelines may yield realistic targets and standardization of medication use accounting for availability and cost.
Lung transplantation (LT) has been demonstrated as the only effective therapy for patients with end-stage lung diseases. Increasing listed lung transplant candidates and expanding volumes of lung transplant centers across China require wellorganized programs and registry data collection based on the large population. This study aimed to summarize and analyze the data of LT development in China.
We retrospectively collected and analyzed data from the China Lung Transplantation Registry (CLuTR). Key data were reported from the registry with transplant types, indications, donor and recipient characteristics, outcomes and survival. The survival <30 days, 1-year and 3-year survival rates were estimated with risk factors identified.
CLuTR contained data from 1053 lung transplants performed through January 1st, 2015 to December 31st, 2018 reported by 18 registered transplant centers. The largest category of diagnosis before transplantation was idiopathic interstitial pneumonitis. The total <30 days, 1-year and 3-year survival rates in CLuTR were 81.45%, 70.11%, and 61.16% with discrepancy by indications. Large proportion of recipients who were more than 60 years old required higher standard of care. Infection-related complications resulted in more death events in the early post-surgery periods. New York Heart Association grading at listing, extra-corporeal membrane oxygenation usage peri-transplantation, allograft dysfunction (primary graft dysfunction >Grade 0), renal insufficiency (estimated glomerular filtration rate <60 mL·min–1·1.73 m–2), were independently associated with a higher risk for 3-year mortality in the entire cohort.
Facing more end-stage of lung diseases and comorbidities, this study analyzed the outcomes and survival of LT recipients in China. Further prospectively stratified analyses with longer follow-up will be needed.
IMpower 133 trial first confirmed the efficacy and safety of adding atezolizumab or placebo to first-line treatment with chemotherapy in patients with extensive-stage small-cell lung cancer (SCLC). While, overprice limited its broad use in clinical. The aim of this study was to evaluate the cost-effectiveness of atezolizumab plus chemotherapy in treatment of extensive SCLC as first line in China.
A Markov model was established by extracting data from the IMpower 133 trial with untreated extensive SCLC patients. Utility values were obtained from published studies, and the costs were acquired from real world and literature. Additionally, sensitivity analyses based on a willingness-to-pay (WTP) threshold were performed to identify the uncertain parameters of Markov model.
Total costs of atezolizumab group were $48,129, while cost of chemotherapy alone was just $12,920 in placebo group. The quality-adjusted life-years (QALYs) in atezolizumab group was just 0.072 higher than that in placebo group (0.858 QALYs vs. 0.786 QALYs). The cost-effectiveness ratio between atezolizumab combination with chemotherapy and chemotherapy alone was $489,013/QALY in China. The net benefit of placebo group was significantly higher than atezolizumab group. One-way sensitivity analyses highlighted that utilities of the progression-free survival (PFS) and progression disease state in placebo group were the most influential parameter.
Atezolizumab combination therapy was not more cost-effective than chemotherapy alone at a WTP threshold of $25,929/QALY in China.
Early diagnosis and accurate staging are important to improve the cure rate and prognosis for pancreatic cancer. This study was performed to develop an automatic and accurate imaging processing technique system, allowing this system to read computed tomography (CT) images correctly and make diagnosis of pancreatic cancer faster.
The establishment of the artificial intelligence (AI) system for pancreatic cancer diagnosis based on sequential contrastenhanced CT images were composed of two processes: training and verification. During training process, our study used all 4385 CT images from 238 pancreatic cancer patients in the database as the training data set. Additionally, we used VGG16, which was pretrained in ImageNet and contained 13 convolutional layers and three fully connected layers, to initialize the feature extraction network. In the verification experiment, we used sequential clinical CT images from 238 pancreatic cancer patients as our experimental data and input these data into the faster region-based convolution network (Faster R-CNN) model that had completed training. Totally, 1699 images from 100 pancreatic cancer patients were included for clinical verification.
A total of 338 patients with pancreatic cancer were included in the study. The clinical characteristics (sex, age, tumor location, differentiation grade, and tumor-node-metastasis stage) between the two training and verification groups were insignificant. The mean average precision was 0.7664, indicating a good training effect of the Faster R-CNN. Sequential contrastenhanced CT images of 100 pancreatic cancer patients were used for clinical verification. The area under the receiver operating characteristic curve calculated according to the trapezoidal rule was 0.9632. It took approximately 0.2 s for the Faster R-CNN AI to automatically process one CT image, which is much faster than the time required for diagnosis by an imaging specialist.
Faster R-CNN AI is an effective and objective method with high accuracy for the diagnosis of pancreatic cancer.
ChiCTR1800017542; http://www.chictr.org.cn.
Artificial intelligence-assisted image recognition technology is currently able to detect the target area of an image and fetch information to make classifications according to target features. This study aimed to use deep neural networks for computed tomography (CT) diagnosis of perigastric metastatic lymph nodes (PGMLNs) to simulate the recognition of lymph nodes by radiologists, and to acquire more accurate identification results.
A total of 1371 images of suspected lymph node metastasis from enhanced abdominal CT scans were identified and labeled by radiologists and were used with 18,780 original images for faster region-based convolutional neural networks (FR-CNN) deep learning. The identification results of 6000 random CT images from 100 gastric cancer patients by the FR-CNN were compared with results obtained from radiologists in terms of their identification accuracy. Similarly, 1004 CT images with metastatic lymph nodes that had been post-operatively confirmed by pathological examination and 11,340 original images were used in the identification and learning processes described above. The same 6000 gastric cancer CT images were used for the verification, according to which the diagnosis results were analyzed.
In the initial group, precision-recall curves were generated based on the precision rates, the recall rates of nodule classes of the training set and the validation set; the mean average precision (mAP) value was 0.5019. To verify the results of the initial learning group, the receiver operating characteristic curves was generated, and the corresponding area under the curve (AUC) value was calculated as 0.8995. After the second phase of precise learning, all the indicators were improved, and the mAP and AUC values were 0.7801 and 0.9541, respectively.
Through deep learning, FR-CNN achieved high judgment effectiveness and recognition accuracy for CT diagnosis of PGMLNs.
Chinese Clinical Trial Registry, No. ChiCTR1800016787; http://www.chictr.org.cn/showproj.aspx?proj= 28515.
Post-operative pain is unpleasant for patients and may worsen surgical recovery. Peri-operative multimodal analgesia has been used for many years; however, its efficacy still needs improvement. In the present study, a thorough peri-operative pain counseling and stratified management program based on risk assessment was implemented, with the goal of improving postoperative analgesia and patient satisfaction.
This prospective, controlled, pilot study included 361 patients who underwent elective surgery. Of these 361 patients, 187 received peri-operative pain risk assessment and stratified analgesia and counseling (stratified analgesia group), while 174 received conventional multimodal analgesia (conventional group). The two groups were compared regarding the post-operative pain intensity, rescue analgesia administration, post-operative quality of recovery as assessed via the quality of recovery 40 questionnaire, total dosage of peri-operative opioids, analgesic satisfaction, and analgesic costs.
Compared with the conventional group, the stratified analgesia group reported decreased pain intensity during motion at 24 h post-operatively and required lower dosages of rescue analgesia (P = 0.03). The total quality of recovery 40 questionnaire score and the scores for physical wellbeing and pain were significantly better in the stratified analgesia group than the conventional group(P = 0.04); the stratified analgesia group also reported better scores for analgesic satisfaction (P = 0.03) and received lower dosages of opioids (P = 0.03). Analgesic costs were lower in the stratified analgesia group than the conventional group; the cost-effective ratio was 109 in the conventional group and 62 in the stratified analgesia group.
The analgesic efficacy was improved by the implementation of stratified analgesia based on surgical pain risk assessment and counseling. This stratified analgesia protocol increased the patients’ analgesic satisfaction and improved the quality of recovery without increasing healthcare costs. The present findings may help improve the efficacy of peri-operative multimodal analgesia in clinical practice.
NCT02728973; https://clinicaltrials.gov/ct2/show/NCT02728973 ?term=NCT02728973 &draw= 2&rank=1.
During cup implantation, vertical height of the cup center (V-HCC) should be precisely controlled to achieve sufficient bone-cup coverage (BCC). Our study aimed to investigate the acetabular bone stock and the quantitative relationship between V-HCC and BCC in Crowe types I to III hips.
From November 2013 to March 2016, pelvic models of 51 patients (61 hips) with hip dysplasia were retrospectively reconstructed using a computer software. Acetabular height and doom thickness were measured on the mid-acetabular coronal cross section. V-HCC was defined as the vertical distance of cup rotational center to the interteardrop line (ITL). In the cup implantation simulation, the cup was placed at the initial preset position, with a V-HCC of 15 mm, and moved proximally by 3-mm increments. At each level, the BCC was automatically calculated by computer. Analysis of variance and Kruskal-Wallis test were used to compare the differences between groups.
There were no significant between-group differences in maximum thickness of the acetabular doom; however, peak bone stock values were obtained at heights of 41.63 ± 5.14 mm (Crowe type I), 47.58 ± 4.10 mm (Crowe type II), and 55.78 ± 3.64 mm(Crowe type III) above the ITL. At 15 mm of V-HCC, median BCC was 78% (75–83%) (Crowe type I), 74% (66–71%) (Crowe type II), and 61% (57–68%) (Crowe type III). To achieve 80% of the BCC, the median V-HCC was 16.27 (15.00–16.93) mm, 18.19(15.01–21.53) mm, and 24.13 (21.02–28.70) mm for Crowe types I, II, and III hips, respectively.
During acetabular reconstruction, slightly superior placement with V-HCC <25 mm retained sufficient bone coverage in Crowe I to III hips.
Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons.
The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People’s Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software.
The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (r2 = 0.65869, P = 0.0014) between infectious group and control group was observed.
The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.
There have been few reports of mutations in the beta-myosin heavy chain (MYH7) gene in hypertrophic cardiomyopathy (HCM), which is associated with sudden cardiac death caused by HCM. This study aimed to screen the mutation sites in the sarcomeric gene MYH7 in Chinese patients with HCM. We also planned to analyze the pathogenicity of the mutation site as well as its significance in clinical and forensic medicine.
From January 2006 to June 2017, autopsy cases were collected from the Department of Pathology, the Affiliated Hospital of Qingdao University. The experiment was to detect MYH7 gene status in formalin-fixed paraffin-embedded tissues from 18 independent autopsy cases who suffered HCM related sudden death (fatal HCM) and 20 cases without cardiomyopathy. Common mutation exon fragments of MYH7 gene were amplified by polymerase chain reaction. The end-of-deoxygenation method and gene cloning method were further performed to analyze the mutation sites. Homologous comparison among mutant sites was conducted using BLAST online database.
The 1336th nucleotide of MYH7 gene at exon 14 was converted from T to G in one HCM case, resulting in the conversion of threonine (Thr) at position 446 to proline (Pro). In another case, the 1402th nucleotide at exon 14 was converted from T to C, resulting in the conversion of phenylalanine (Phe) at position 468 to leucine (Leu). Homologous comparison results showed that the two amino acid residues of Thr446 and Phe468 are highly conserved among different species.
Our results showed fatal HCM harbored mutations of Thr446Pro and Phe468Leu in the MYH7 gene. It is significant for clinical and forensic medicine to further explore the functions and detailed mechanisms of these mutations.
No DataIn recent years, an increasing number of drugs have been proved to be associated with the induction of anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis (AAV). This article reviews the latest research progress on drug-induced AAV. Data sources: We conducted a comprehensive and detailed search of the PubMed database. The search terms mainly included druginduced, ANCA, and vasculitis.
We summarized the original articles and reviews on drug-induced AAV in recent years. The extracted information included the definition, epidemiology, associated drugs, pathogenesis, clinical features, diagnosis, treatment, and prognosis of druginduced AAV. We also focused on the differences between drug-induced AAV and primary vasculitis.
The offending drugs leading to drug-induced AAV are almost from pharmacologic categories and we need to be vigilant when using these drugs. The pathogenesis of drug-induced AAV might be multifactorial. The formation of neutrophil extracellular traps is an important mechanism for the development of drug-induced AAV. The clinical features of drug-induced AAV are similar to those of primary AAV. Understanding the difference between drug-induced AAV and primary AAV is helpful to identify druginduced AAV. Stopping the offending drug at once after diagnosis may be sufficient for those patients with mild symptoms. Immunosuppressive therapy should only be used in patients with vital organs involvement.
Patients with drug-induced AAV usually have a good prognosis if they stop using the offending drug immediately. Recent advances in research on AAV are expected to help us better understand the pathogenesis of drug-induced AAV.
Adult-onset Still’s disease (AOSD) is a rare but clinically well-known polygenic systemic autoinflammatory disease. In this review, we aim to present frontiers in the pathogenesis, clinical features, diagnosis, biomarkers, disease course, prognosis, and treatment in AOSD.
We retrieved information from the PubMed database up to July 2019, using various search terms and relevant words, including AOSD and Still’s disease.
We included data from peer-reviewed journals. Both basic and clinical studies were selected.
Pathogenesis of AOSD involves genetic background, infectious triggers, and immunopathogenesis, mainly the activation of macrophages and neutrophils followed by a cytokine storm. Diagnosis and prognosis evaluation of AOSD is still challenging; therefore, there is an urgent need to identify better biomarkers. Biologic agents, including interleukin (IL)-1β, IL-6, and tumor necrosis factor-α antagonists in the treatment of AOSD, have good prospect.
This review highlights the advances in pathogenesis, potential biomarkers, disease course, and treatment in AOSD.
Systemic sclerosis (SSc) is a remarkably systemic heterogeneous connective tissue disease with many organs involved. The heart is one of the major organs involved, carrying the threat of sudden cardiac death, especially in diffuse cutaneous SSc. This review summarizes the pathophysiology, types, new diagnostic approaches, and imaging and novel therapies of primary cardiac complications while underlining the effects of recently developed non-contrast cardiovascular magnetic resonance (CMR) in early diagnosis.
Medline and Embase were searched for articles published up to July 2019. A combination of Medical Subject Headings (MeSH) terms and keywords pertaining to SSc ( "Scleroderma, Systemic" OR "Systemic sclerosis" OR" SSc" ), AND cardiology ( "cardiology" OR "heart" OR "cardiac" ) were applied to the search strategies.
Literature was mainly printed in English and Chinese about cardiac complications in systemic sclerosis. After selected simply on the title and abstract, the articles were included for the full text. Article type was not limited.
Relevant cardiac manifestations are complex, including arrhythmias, pericardial effusion, myocardial dysfunction, and valvular diseases. Even though the symptoms of cardiac complications are well known, unfortunately, they appear to be poor prognostic factors. As systemic sclerosis with cardiac complications has a high mortality rate and patients might have a poor quality of life, it is essential to promote early diagnosis and treatment. With the advent of non-invasive imaging techniques, such as CMR, early diagnosis of cardiac complications in SSc is becoming more effective.
Cardiac complications play an essential role in SSc and carry the threat of sudden cardiac death. More basic and clinical studies are warranted to develop better management of cardiac involvement in patients with SSc.
Renal fibrosis is the most common manifestation of chronic kidney disease (CKD). Noting that existing treatments of renal fibrosis only slow disease progression but do not cure it, there is an urgent need to identify novel therapies. Hydrogen sulfide(H2S) is a newly discovered endogenous small gas signaling molecule exerting a wide range of biologic actions in our body. This review illustrates recent experimental findings on the mechanisms underlying the therapeutic effects of H2S against renal fibrosis and highlights its potential in future clinical application.
Literature was collected from PubMed until February 2019, using the search terms including "Hydrogen sulfide," "Chronic kidney disease," "Renal interstitial fibrosis," "Kidney disease," "Inflammation factor," "Oxidative stress," "Epithelialto-mesenchymal transition," "H2S donor," "Hypertensive kidney dysfunction," "Myofibroblasts," "Vascular remodeling," "transforming growth factor (TGF)-beta/Smads signaling," and "Sulfate potassium channels."
Literature was mainly derived from English articles or articles that could be obtained with English abstracts. Article type was not limited. References were also identified from the bibliographies of identified articles and the authors’ files.
The experimental data confirmed that H2S is widely involved in various renal pathologies by suppressing inflammation and oxidative stress, inhibiting the activation of fibrosis-related cells and their cytokine expression, ameliorating vascular remodeling and high blood pressure, stimulating tubular cell regeneration, as well as reducing apoptosis, autophagy, and hypertrophy. Therefore, H2S represents an alternative or additional therapeutic approach for renal fibrosis.
We postulate that H2S may delay the occurrence and progress of renal fibrosis, thus protecting renal function. Further experiments are required to explore the precise role of H2S in renal fibrosis and its application in clinical treatment.
特应性皮炎（AD）是一种以慢性复发性皮炎伴深度瘙痒为特征的炎症性皮肤病。大多数患者有特应性疾病的个人和/或家族史。[
No DataCURRENT ISSUE
